View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1634_high_32 (Length: 239)
Name: NF1634_high_32
Description: NF1634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1634_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 42904067 - 42904284
Alignment:
| Q |
1 |
cgtgcggcatggccgtgatagctatttttctaaacacacaaatatcattattgcatgtaccataatctcatttcacttgcaccatagccattggcgaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42904067 |
cgtgcggcatggccgtgatagctatttt-ctaaacacacaaatatcattattccgtgtaccataatctcatttgacttgcaccatagccattggcgaaaa |
42904165 |
T |
 |
| Q |
101 |
ataatgccatctttactatttatctcctccctatctttcttatttttcttcaaccattcctagctacctctaggtgaacacttttatagataaatagttt |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42904166 |
a--atgccatctttactatttatctcctccctatctttcttatttttcttcaaccattcctagctacctctaggtgaacacttttatagataaatagttt |
42904263 |
T |
 |
| Q |
201 |
atcgtggattgatactttgaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42904264 |
atcgtggattgatactttgaa |
42904284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University