View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1634_low_11 (Length: 421)

Name: NF1634_low_11
Description: NF1634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1634_low_11
NF1634_low_11
[»] chr3 (1 HSPs)
chr3 (162-199)||(19852504-19852541)


Alignment Details
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 199
Target Start/End: Complemental strand, 19852541 - 19852504
Alignment:
162 atgttgaattttgctgaatgtagtaattttctcataca 199  Q
    ||||||||||||||||||||||||||||||||||||||    
19852541 atgttgaattttgctgaatgtagtaattttctcataca 19852504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University