View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1634_low_16 (Length: 350)
Name: NF1634_low_16
Description: NF1634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1634_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 6 - 329
Target Start/End: Original strand, 43581877 - 43582200
Alignment:
| Q |
6 |
agaagcaaaggtataggttgtcctctaacttggtagcttaatggacatttgatgtgttggagcacgtcttcgaatccgcaattccccgcttatccacaac |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43581877 |
agaaacaaaggtataggttgtcctctaacttggtagcttaatggacatttgatgtgttggagcacgtcttcgaatccgcaattccccgcttatccacaac |
43581976 |
T |
 |
| Q |
106 |
gaaagtgtgtgattctcactacttaaagcgaagtggtttgaaacttattcggcagacaactctttggtcgatttggaaggctaggaacggcagatgcttc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43581977 |
gaaagtgtgtgattctcactacttaaagcgaagtggtttgaaacttattcggcagacaactctttggtcgatttggaaggctaggaacgacagatgcttc |
43582076 |
T |
 |
| Q |
206 |
aacaacactactggggcagctaccgagactgtggacgggatcgtggataaaattaaagtgctctcatggaggtggtttctagggagacatgaaaatactc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43582077 |
aacaacactactggggcagctaccgagactgtggacgggatcgttgataaaattaaagtgctctcatggaggtggtttctagggagacatgaaaatactc |
43582176 |
T |
 |
| Q |
306 |
catgtatgttttaggagtggtcgt |
329 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43582177 |
catgtatgttttaggagtggtcgt |
43582200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University