View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1634_low_26 (Length: 277)
Name: NF1634_low_26
Description: NF1634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1634_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 128 - 261
Target Start/End: Complemental strand, 1802292 - 1802163
Alignment:
| Q |
128 |
ggatgagacactgcctaccactcagtatcaagttcgttccaagaaggcggaggggattcaaaaactaaatgttgcattttatttttattttcgtttaatg |
227 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1802292 |
ggatgagacattgtctaccactcagtatcaagttc----caagaaggcggaggggtttcagaaactaaatgttgcattttatttttattttggtttaatg |
1802197 |
T |
|
| Q |
228 |
taaacggtgaattgatgaatgttagtatgtaatt |
261 |
Q |
| |
|
|||| |||||||| |||||||||| ||||||||| |
|
|
| T |
1802196 |
taaatggtgaattaatgaatgttactatgtaatt |
1802163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University