View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1634_low_29 (Length: 259)
Name: NF1634_low_29
Description: NF1634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1634_low_29 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
| [»] scaffold0571 (1 HSPs) |
 |  |  |
|
| [»] scaffold0598 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 134 - 259
Target Start/End: Original strand, 1829549 - 1829674
Alignment:
| Q |
134 |
tgctttgatatgctcaaatatatgcttttcaaccatgtgttgtccagatttacacagatttattagatagactaatgatactgaggaagcatagtatcta |
233 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1829549 |
tgctttgatatggtcaaatatatgcttttcgaccatgtgttgtccaggtttacacagattaattagatagactaatgatactgaggaagcatagtatcta |
1829648 |
T |
 |
| Q |
234 |
atttttggaagatatcgttactcttt |
259 |
Q |
| |
|
||||||||||||||||| |||||||| |
|
|
| T |
1829649 |
atttttggaagatatcgctactcttt |
1829674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 65 - 159
Target Start/End: Original strand, 1814212 - 1814306
Alignment:
| Q |
65 |
tgtttgtgtatgtgcttcataggtgacttgtggttggttgttatcttttttataaactccnnnnnnnngtgctttgatatgctcaaatatatgct |
159 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
1814212 |
tgtttgtgtatgcgcttcataggtgacttgtggttggttgttatcttttttataaactccttttttttgtgctttgatatgctcacttatatgct |
1814306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 58 - 119
Target Start/End: Original strand, 1829461 - 1829526
Alignment:
| Q |
58 |
tgtgtcgtgtttgtgtatgtgcttcata----ggtgacttgtggttggttgttatcttttttataa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
1829461 |
tgtgtcgtgtttgtgtatgtgcttcatatataggtgacttgtggttggttgttatctttgttataa |
1829526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0571 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0571
Description:
Target: scaffold0571; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 7727 - 7692
Alignment:
| Q |
1 |
attgaattatgtcattttctcaaattgttatcagta |
36 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7727 |
attgaattatgtcattttctcaaattattatcagta |
7692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 11596477 - 11596516
Alignment:
| Q |
1 |
attgaattatgtcattttctcaaattgttatcagtatcga |
40 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
11596477 |
attgaattatgtcattttctcaaattattatcggtatcga |
11596516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 5654613 - 5654652
Alignment:
| Q |
1 |
attgaattatgtcattttctcaaattgttatcagtatcga |
40 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
5654613 |
attgaattatgtcattttctcaaattattatcagtgtcga |
5654652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 34589728 - 34589759
Alignment:
| Q |
1 |
attgaattatgtcattttctcaaattgttatc |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34589728 |
attgaattatgtcattttctcaaattgttatc |
34589759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 43188649 - 43188615
Alignment:
| Q |
1 |
attgaattatgtcattttctcaaattgttatcagt |
35 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
43188649 |
attgaattatgtcattttctcaaattattatcagt |
43188615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 10546185 - 10546153
Alignment:
| Q |
1 |
attgaattatgtcattttctcaaattgttatca |
33 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
10546185 |
attgaattatgtcattttctcaaattattatca |
10546153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 13807206 - 13807172
Alignment:
| Q |
1 |
attgaattatgtcattttctcaaattgttatcagt |
35 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
13807206 |
attgaattatgtgattttctcaaattgttatcagt |
13807172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 40017391 - 40017421
Alignment:
| Q |
1 |
attgaattatgtcattttctcaaattgttat |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40017391 |
attgaattatgtcattttctcaaattgttat |
40017421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 35
Target Start/End: Complemental strand, 20691354 - 20691322
Alignment:
| Q |
3 |
tgaattatgtcattttctcaaattgttatcagt |
35 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
20691354 |
tgaattatgtcattttctcaaattattatcagt |
20691322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0598 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0598
Description:
Target: scaffold0598; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 3 - 40
Target Start/End: Original strand, 8077 - 8114
Alignment:
| Q |
3 |
tgaattatgtcattttctcaaattgttatcagtatcga |
40 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
8077 |
tgaattatgtcattttctcaaattattatccgtatcga |
8114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 44172912 - 44172944
Alignment:
| Q |
1 |
attgaattatgtcattttctcaaattgttatca |
33 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
44172912 |
attgaattatgtcattttctcaaattattatca |
44172944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 2140503 - 2140535
Alignment:
| Q |
1 |
attgaattatgtcattttctcaaattgttatca |
33 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
2140503 |
attgaattatgtcattttctcaaattattatca |
2140535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University