View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1634_low_32 (Length: 242)
Name: NF1634_low_32
Description: NF1634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1634_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 24 - 228
Target Start/End: Complemental strand, 16522173 - 16521969
Alignment:
| Q |
24 |
cgagtacaatctcggagttaagagtattaatctctccgttgagattgaactagctttcctaaccacagttctttcattttcttgattacttcttgaagaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16522173 |
cgagtacaatctcggagttaagagtatcaatctctccgttgagattgaactagctttcctaaccacagttctttcattttcttgattacttcttgaagaa |
16522074 |
T |
 |
| Q |
124 |
gatcttgaaaaagttcatgcggactgattgaagaatttagattctttatatgagtttcatgcatttaggcaaaagtttgttagaacacagattgaatctt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16522073 |
gatcttgaaaaagttcatgcggactgattgaagaatttagattctttatatgagtttcatgcatttaggcaaaagtttgttagaacacagattgaatctt |
16521974 |
T |
 |
| Q |
224 |
ttgtt |
228 |
Q |
| |
|
||||| |
|
|
| T |
16521973 |
ttgtt |
16521969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University