View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1634_low_34 (Length: 232)
Name: NF1634_low_34
Description: NF1634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1634_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 213
Target Start/End: Complemental strand, 53621401 - 53621202
Alignment:
| Q |
14 |
aagcaaaggatgatccaatgaagtattgattctcgatataaataaaatgctgagcagatctgatggcatgtatgtaagctgtttgaatactcttgtctat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53621401 |
aagcaaaggatgatccaatgaagtattgattctcgatataaataaaatgctgagcagatctgatggcatgtatgtaagctgtttgaatactcttgtctat |
53621302 |
T |
|
| Q |
114 |
gactaaatttttagcacaaacaagattctgcaatgagtggttgacaaattttttaattagtgaaagcgggaaaacacaaggctctataacatatagccat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53621301 |
gactaaatttttagcacaaacaagattctgcaatgagtggttgacaaattttttaattagtgaaagcgggaaaacacaaggctctataacatatagccat |
53621202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 25 - 146
Target Start/End: Complemental strand, 9154888 - 9154767
Alignment:
| Q |
25 |
gatccaatgaagtattgattctcgatataaataaaatgctgagcagatctgatggcatgtatgtaagctgtttgaatactcttgtctatgactaaatttt |
124 |
Q |
| |
|
|||||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || || |||||||||| || || ||||| ||||||| |
|
|
| T |
9154888 |
gatccaataaagtattggttttcaatataaatgaaatgttgagcagatctgatagcttggatatatcctgtttgaatgcttttttctatagtcaaatttt |
9154789 |
T |
|
| Q |
125 |
tagcacaaacaagattctgcaa |
146 |
Q |
| |
|
||||||| | ||||||||||| |
|
|
| T |
9154788 |
tagcacatatgagattctgcaa |
9154767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University