View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1634_low_36 (Length: 224)
Name: NF1634_low_36
Description: NF1634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1634_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 6 - 105
Target Start/End: Original strand, 31766922 - 31767021
Alignment:
| Q |
6 |
atttggggtttagaatgcaagttaatttaaatgagaagaagttgatctatgattcagttgatgaaaagtagttaagaaagactacaaatttttcctctca |
105 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31766922 |
atttggggtttagaatgcatgttaatttaaatgagaagaagttgatctatgattcagttgatgaaaagtagttaagaaagactacaaatttttcgtctca |
31767021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 177 - 224
Target Start/End: Original strand, 31767093 - 31767140
Alignment:
| Q |
177 |
ttagtcacataaaatttaagacttacaatgaaaacaataaattgaaaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31767093 |
ttagtcacataaaatttaagacttacaatgaaaacaataaattgaaaa |
31767140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 78
Target Start/End: Complemental strand, 31750501 - 31750451
Alignment:
| Q |
28 |
taatttaaatgagaagaagttgatctatgattcagttgatgaaaagtagtt |
78 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
31750501 |
taatttaaatgagaacaagttgatctatgattcatttgatgaaaagtagtt |
31750451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University