View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16350_high_3 (Length: 313)
Name: NF16350_high_3
Description: NF16350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16350_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 17 - 303
Target Start/End: Original strand, 7645720 - 7646003
Alignment:
| Q |
17 |
agctttttccttctctttcacctcgcttccctgtgtcttgtcataatcttcatgcacaaaaacaaacaagtctgaattaggcttaataattaatttccat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7645720 |
agctttttccttctctttcacctcgcttccctgtgtcttgtcataatcttcatgcacaaaaacaaacaagtcttaattaggcttaataattaatttccat |
7645819 |
T |
|
| Q |
117 |
catgacctctacaaaagtaataagaaattgacggtgtaaaatgttttaaacgtaaggnnnnnnnctagttgtccatgtatgatcataagcaaattaacta |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7645820 |
---gacctctacaaaagtaataagaaaatgacggtgtaaaatgttttaaacgtaaggaaaaaaactagttgtccatgtatgatcataagcaaattaacta |
7645916 |
T |
|
| Q |
217 |
attataacctgggtgattttcatggacggacttatctttctgaagggattggtttccactatatatccctccaaatccttcttcatc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7645917 |
attataacctgggtgattttcatggacggacttatctttctgaagggattggtttccaccatatatccctccaaatccttcttcatc |
7646003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University