View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16351_low_4 (Length: 334)
Name: NF16351_low_4
Description: NF16351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16351_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 178 - 319
Target Start/End: Complemental strand, 52471779 - 52471637
Alignment:
| Q |
178 |
agaagcaaattatatgcttgaacgactttgagagcgaacaaaaacagagnnnnnnn-ctatggtaagatcatctttcctccattatatttttctcttatt |
276 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52471779 |
agaagaaaattatatgcttgaacgactttgagagctaacaaaaacagagaaaaaaaactatggtaagatcatctttcctccattatatttttctcttatt |
52471680 |
T |
 |
| Q |
277 |
atcaatttggaccctaaatttatccatttattatcaatttagt |
319 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52471679 |
atctatttggaccctaaatttatccatttattatcaatttagt |
52471637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University