View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16351_low_6 (Length: 286)
Name: NF16351_low_6
Description: NF16351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16351_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 12 - 264
Target Start/End: Complemental strand, 45953647 - 45953395
Alignment:
| Q |
12 |
acagataacacaacttggccatgttaaggtatgaattaaatgaacctttagatgttgaagttctttagcagatcatatagtatgttcaattttgtgattt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45953647 |
acagataacacaacttggccatgttaaggtatgaattaaatgaacctttagatgttgaagttctttagcagatcatatagtatgttcaattttgtgattt |
45953548 |
T |
 |
| Q |
112 |
gaagacttggaatgagaaagtatgtacatgttgagaagtccttcattggatgagatatgatctgaaaaagtgtttacaagtggtagacagtcctcaagtt |
211 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45953547 |
gaagacttggaatgagaaagattgtacatgttgagaagtccttcattggatgagatatgatctgaaaaagtgtttacaagtggtagacagtcctcatgtt |
45953448 |
T |
 |
| Q |
212 |
actgctgattttgcagcggttctctttggccatgcttcagatgcattgatcac |
264 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45953447 |
actgctgattttgaagcggttctctttggccatgcttcagatgcattgatcac |
45953395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 1221628 - 1221678
Alignment:
| Q |
155 |
cattggatgagatatgatctgaaaaagtgtttacaagtggtagacagtcct |
205 |
Q |
| |
|
|||||||||||||||||||||| || ||||||| ||||||| |||| |||| |
|
|
| T |
1221628 |
cattggatgagatatgatctgagaatgtgtttataagtggtggacaatcct |
1221678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University