View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16352_high_3 (Length: 374)
Name: NF16352_high_3
Description: NF16352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16352_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 17 - 152
Target Start/End: Original strand, 42335313 - 42335448
Alignment:
| Q |
17 |
acaacaacaagatcatcgttgagaagccgcttaagtttccaaatttctccggcgaagacgacgaaggagtttgcattgatgacttggctcatcgtgctgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42335313 |
acaacaacaagatcatcgttgagaagccgcttaagtttccaaatttctccggcgaatacgacgaaggagtttgcattgatgacttggctcatcgtgctgg |
42335412 |
T |
 |
| Q |
117 |
atattatcccattcaacactctcatgctgctaagta |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42335413 |
atattatcccattcaacactctcatgctgctaagta |
42335448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 250 - 357
Target Start/End: Original strand, 42335540 - 42335647
Alignment:
| Q |
250 |
gtaattgcttaaagtattactttatttagtgaatcattaaaataattatagattatgttctctaactgaccctgggatttgtcttcattgaatttaattg |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42335540 |
gtaattgcttaaagtattactttatttagtgaatcattaaaataattatagattatgttctctaactgaccctgggatttgtcttcattgaatttaattg |
42335639 |
T |
 |
| Q |
350 |
tttaattt |
357 |
Q |
| |
|
|||||||| |
|
|
| T |
42335640 |
tttaattt |
42335647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University