View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16353_low_5 (Length: 249)
Name: NF16353_low_5
Description: NF16353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16353_low_5 |
 |  |
|
| [»] scaffold0172 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0172 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: scaffold0172
Description:
Target: scaffold0172; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 24 - 235
Target Start/End: Original strand, 8301 - 8512
Alignment:
| Q |
24 |
cgagtcttgagaagatttcttgataacaacaggggctacaactttcttatcatgattagatttgatcttccacttagaactcaatggtttatcatcatcg |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8301 |
cgagtcttgagaagatttcttgataacaacaggagctacaactttgttatcatgattagatttgatcttccacttagaactcaatggtttatcatcatcg |
8400 |
T |
 |
| Q |
124 |
tcatcctctgaatcttcacaataacctttactagagtgttcgataggtttcgtttcattcttcacattaacaatatttggtttatcccctaatgaaggcg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8401 |
tcatcctctgaatcttcacaataacctttactagagtgttcgataggtttcgtttcattcttcacattaacaatatttggtttatcccctaatgaaggcg |
8500 |
T |
 |
| Q |
224 |
aattcgattgtt |
235 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8501 |
aattcgattgtt |
8512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University