View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16355_low_19 (Length: 216)
Name: NF16355_low_19
Description: NF16355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16355_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 8 - 206
Target Start/End: Original strand, 32024800 - 32024994
Alignment:
| Q |
8 |
gtgaaatgaagacaaaccaaacatacacttagtttgttcgttgacctttgataatctttaataatgaggaaaatagatatgtgagtctcttttgggttga |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32024800 |
gtgaaaagaagacaaaccaaacatacacttagtttgtt----gacctttgataatctttaataatgaggaaaatagatatgtgagtctcttttgggttga |
32024895 |
T |
|
| Q |
108 |
actgtgtgattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgttttctatttaatttgttgatttgggtttatgtttgatgatgat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32024896 |
actgtgtgattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgttttctatttaatttgttgatttgggtttatgtttgatgttgat |
32024994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 84 - 169
Target Start/End: Original strand, 32026304 - 32026389
Alignment:
| Q |
84 |
atatgtgagtctcttttgggttgaactgtgtgattaaatggaattttgatgatctgtgtgtttgacttcttttgggttgttttcta |
169 |
Q |
| |
|
|||||||| |||||||||| || || ||| ||| |||||| |||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
32026304 |
atatgtgaatctcttttggatttaagtgtatgagtaaatgaaattttgatgatctgtgtgtttgacttcattttggttgttttcta |
32026389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University