View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16357_high_13 (Length: 216)
Name: NF16357_high_13
Description: NF16357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16357_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 13719368 - 13719182
Alignment:
| Q |
19 |
atctttaaaatcttaacttatgtcttaagaacacaagttaacatttcgtttgatttaataagcttttaaaggaattgtcccacatgagaagttttgaaaa |
118 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
13719368 |
atctttaaaattgtaacttatgtcttaagggcacaagttaacatttcgtttgatttaataaacttttaaacgaattgtcccacatgagaatttttgaaaa |
13719269 |
T |
 |
| Q |
119 |
atagagaagaatattttatctaaaaaagcaacaatgtatgacagagaaaggcactcttagtttgagtctacattgcagtattatcta |
205 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13719268 |
atagagaagaatattttatctaaaaaaacaacaatgtatgacagagaaaggcactcttagtttgagtctacatcgcagtattatcta |
13719182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 32280429 - 32280465
Alignment:
| Q |
29 |
tcttaacttatgtcttaagaacacaagttaacatttc |
65 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32280429 |
tcttaacttatgtcttaagggcacaagttaacatttc |
32280465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University