View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16357_low_11 (Length: 250)
Name: NF16357_low_11
Description: NF16357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16357_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 61 - 202
Target Start/End: Complemental strand, 5127489 - 5127348
Alignment:
| Q |
61 |
ataacttgttggttgatgtcaacaatttaatccgatatttgtacgcaagagtctcaacaaaaggaaagaggatgaagatgtgattgacacttgaaaacaa |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5127489 |
ataacttgttggttgatgtcaacaatttaatccgatatttgtacgcaagagtctcaacaaaaggaaagaggatgaagatgtgattgacacttgaaaacaa |
5127390 |
T |
|
| Q |
161 |
agttgaagttaaggagaacaagattgcagtatattgacatat |
202 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5127389 |
tgttgaagttaaggagaataagattgcagtatattgacatat |
5127348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 188 - 250
Target Start/End: Complemental strand, 5127331 - 5127269
Alignment:
| Q |
188 |
agtatattgacatatcttgtagatgtagacgagttgctgaaatcaacatttccaaaacctgcc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5127331 |
agtatattgacatatcttgtagatgtagacgagttgctgaaatcaacatttccaaaacctgcc |
5127269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 5128369 - 5128314
Alignment:
| Q |
1 |
tagtaaaataatgtgtgtagcgtaaattagagtggttgattatagtgtgcgggaaa |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5128369 |
tagtaaaataatgtgtgtagcgtaaattagagtggttgattatagtgtgcgggaaa |
5128314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University