View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16357_low_13 (Length: 219)
Name: NF16357_low_13
Description: NF16357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16357_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 16 - 202
Target Start/End: Complemental strand, 28162202 - 28162016
Alignment:
| Q |
16 |
aatattcaataaccaattcaagaaaaatcagaatacattnnnnnnnnnnnnttccaattatatgctaagatgttcatcccttggcaagctttgaactgta |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28162202 |
aatattcaattaccaattcaagaaaaatcagaatgcattaaaaataaaaaattccaattatatgctaagatgttcatcccttggcaagctttgaactgta |
28162103 |
T |
|
| Q |
116 |
tctgaccatctaccaggtgaatgatcactactgttattagatgagacatgagcttctcctcttgcatctcttatcatctttagaact |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28162102 |
tctgaccatctaccaggtgaatgatcactactgttattagatgagacatgagcttctcctcttgcatctcttatcatctttagaact |
28162016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University