View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16358_high_12 (Length: 228)
Name: NF16358_high_12
Description: NF16358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16358_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 38 - 186
Target Start/End: Complemental strand, 48766703 - 48766555
Alignment:
| Q |
38 |
ataactccaaatgaatacacatccgatttggggtttgattttatgttttgaaacgattctggtgcttggtatggcacttgacccccacaagtagatgatg |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48766703 |
ataactccaaatgaatacacatccgatttggggtttgattttatgttttgaaacgattctggtgcttggtatggcacttgacccccacaagtagatgatg |
48766604 |
T |
 |
| Q |
138 |
atggccccattgtcccataggggctaggagttgaaccaatggaaatgtc |
186 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48766603 |
atggccccattgttccataggggctaggagttgaaccaatggaaatgtc |
48766555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University