View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16358_low_8 (Length: 258)
Name: NF16358_low_8
Description: NF16358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16358_low_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 48 - 258
Target Start/End: Original strand, 52878149 - 52878359
Alignment:
| Q |
48 |
ccttttgaagtcatgttaatcgtatgttggatgtgaacaatcatattcgtttgttgtcaagcaaacttaacctcaaagttaaaatgcaacaataaaatac |
147 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52878149 |
ccttttgaaatcatgttaatcgtatgttggatgtgaacaatcatattcgtttgttgtcaagcaaacttaacctcaaagttaaaatgcaacaataaaatac |
52878248 |
T |
 |
| Q |
148 |
tcttaatattaaagatcaagacactaaattttaagacacaaacatgtcttagagagaatagtctcgatcataactttagagtcgctttcaaagataatat |
247 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52878249 |
tcttaatattagagatcaagacactaaattttaagacacaaacatgtcttagagagaatagtctcgatcataactttagagtcgctttcaaagataacat |
52878348 |
T |
 |
| Q |
248 |
gatcaacacct |
258 |
Q |
| |
|
||||||||||| |
|
|
| T |
52878349 |
gatcaacacct |
52878359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University