View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16359_high_8 (Length: 210)
Name: NF16359_high_8
Description: NF16359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16359_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 28239690 - 28239875
Alignment:
| Q |
20 |
aacttcccattgatgtgctctcaatctggcttttcttctttcnnnnnnnnagaaaaatgatcaggtgaatagtgacaggctcagagaaagtctcgagaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28239690 |
aacttcccattgatgtgctctcaatctggcttttcttctttcttttttttagaaaaatgatcaggtgaatagtgacaggctcagagaaagtctcgagaaa |
28239789 |
T |
|
| Q |
120 |
atagtcggtacagatgattcgaggtttagtggatttgaccttgctactcttatcaggaacaaatatgggaaatctgatgatgtcca |
205 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28239790 |
atagtcggtacagatgattcgagatttagtggatttgaccttgctactcttatcaggaacaaatatgggaaatcttatgatgtcca |
28239875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University