View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16359_low_8 (Length: 254)
Name: NF16359_low_8
Description: NF16359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16359_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 53 - 205
Target Start/End: Complemental strand, 47609387 - 47609233
Alignment:
| Q |
53 |
attgtgcttttggtcagtactattcaaaatgtgcttgcactattatgcagttgcttatgatgaatttttgagttactagagagatgtttgacttagttct |
152 |
Q |
| |
|
|||| ||||| ||| ||| |||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47609387 |
attgagctttgggttagttctattcaaaatgtgcttgcaatattatgtagttgcttatgatgaatttttgagttactagagagatgtttgacttagttct |
47609288 |
T |
 |
| Q |
153 |
tggttttgtttcctctgtgtgatatgctatt--tttcagcgactgaccgaattat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
47609287 |
tggttttgtttcctctgtgtgatatgctatttcttttagcaactgaccgaattat |
47609233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 53 - 181
Target Start/End: Complemental strand, 47604889 - 47604761
Alignment:
| Q |
53 |
attgtgcttttggtcagtactattcaaaatgtgcttgcactattatgcagttgcttatgatgaatttttgagttactagagagatgtttgacttagttct |
152 |
Q |
| |
|
|||| ||||| ||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47604889 |
attgagctttgggtcagttctattcaaaatgtgcttgcaatattatttagttgcttatgatgaatttttgagttactagagagatgtttgacttagttct |
47604790 |
T |
 |
| Q |
153 |
tggttttgtttcctctgtgtgatatgcta |
181 |
Q |
| |
|
|||||||||||||||||||| |||||||| |
|
|
| T |
47604789 |
tggttttgtttcctctgtgttatatgcta |
47604761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 180 - 243
Target Start/End: Complemental strand, 47604479 - 47604416
Alignment:
| Q |
180 |
tatttttcagcgactgaccgaattatattatctctaaatctctttgtatgaaggcctatgctac |
243 |
Q |
| |
|
||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47604479 |
tattttttagcgactgaccgagttatatcatctctaaatctctttgtatgaaggcctatgctac |
47604416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 103 - 163
Target Start/End: Complemental strand, 19991472 - 19991412
Alignment:
| Q |
103 |
ttgcttatgatgaatttttgagttactagagagatgtttgacttagttcttggttttgttt |
163 |
Q |
| |
|
|||| ||| ||||||||||||||||||||| ||||| ||||||| |||||| ||||||||| |
|
|
| T |
19991472 |
ttgcatataatgaatttttgagttactagaaagatgcttgactttgttcttagttttgttt |
19991412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 118 - 155
Target Start/End: Complemental strand, 4287778 - 4287741
Alignment:
| Q |
118 |
ttttgagttactagagagatgtttgacttagttcttgg |
155 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
4287778 |
ttttgatttactagagagatgtttgactttgttcttgg |
4287741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University