View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16360_high_10 (Length: 234)
Name: NF16360_high_10
Description: NF16360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16360_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 12 - 114
Target Start/End: Complemental strand, 48754312 - 48754210
Alignment:
| Q |
12 |
atcatcatatgtagttaatacaaacaagagaatcataattcaaatttctgctagagcaacctaacaaagctttatcataaatatgaactgtcaaacctta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
48754312 |
atcatcatatgtagttaatacaaacaagagaatcataattcaaatttctgctagagcaacctaacaaagccttatcataaatatgaactgtcaaaactta |
48754213 |
T |
|
| Q |
112 |
acc |
114 |
Q |
| |
|
||| |
|
|
| T |
48754212 |
acc |
48754210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 32 - 105
Target Start/End: Complemental strand, 35914421 - 35914347
Alignment:
| Q |
32 |
caaacaagagaat-cataattcaaatttctgctagagcaacctaacaaagctttatcataaatatgaactgtcaa |
105 |
Q |
| |
|
||||| ||||||| |||||||||||| ||||||||||||||||||||||||||||| | |||| | ||||||||| |
|
|
| T |
35914421 |
caaacgagagaattcataattcaaatatctgctagagcaacctaacaaagctttataagaaatgttaactgtcaa |
35914347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University