View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16360_low_12 (Length: 234)

Name: NF16360_low_12
Description: NF16360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16360_low_12
NF16360_low_12
[»] chr1 (1 HSPs)
chr1 (12-114)||(48754210-48754312)
[»] chr4 (1 HSPs)
chr4 (32-105)||(35914347-35914421)


Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 12 - 114
Target Start/End: Complemental strand, 48754312 - 48754210
Alignment:
12 atcatcatatgtagttaatacaaacaagagaatcataattcaaatttctgctagagcaacctaacaaagctttatcataaatatgaactgtcaaacctta 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||    
48754312 atcatcatatgtagttaatacaaacaagagaatcataattcaaatttctgctagagcaacctaacaaagccttatcataaatatgaactgtcaaaactta 48754213  T
112 acc 114  Q
    |||    
48754212 acc 48754210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 32 - 105
Target Start/End: Complemental strand, 35914421 - 35914347
Alignment:
32 caaacaagagaat-cataattcaaatttctgctagagcaacctaacaaagctttatcataaatatgaactgtcaa 105  Q
    ||||| ||||||| |||||||||||| ||||||||||||||||||||||||||||| | |||| | |||||||||    
35914421 caaacgagagaattcataattcaaatatctgctagagcaacctaacaaagctttataagaaatgttaactgtcaa 35914347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University