View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16362_high_6 (Length: 309)
Name: NF16362_high_6
Description: NF16362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16362_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 38 - 235
Target Start/End: Complemental strand, 25570621 - 25570422
Alignment:
| Q |
38 |
tgttgctgaacccatcaaatatgcctcgtcttcttgttgttgaacctggaaaagaaaagaaaattcaaccctttcctcaatcaaagatctaggcctggaa |
137 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25570621 |
tgttgctgaacccatcaaatctgcctcgttttcttgttgttgaacccggaaaagaaaagaaatttcaaccctttcctcaa-caaagatctaggcctggaa |
25570523 |
T |
|
| Q |
138 |
aaacaataacaatcaatccaatcagttt---aagnnnnnnnnnnnctaacaaatgaaaactacctgcacaccaccagcgacgaattcgagttttgcaaca |
234 |
Q |
| |
|
|||||| ||||||||||||||||||||| || ||||||||||||||| ||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
25570522 |
aaacaacaacaatcaatccaatcagtttcagaaaagaaaaaaaaactaacaaatgaaaaccaccagcacaccaccagcgacgaattcaagttttgcaaca |
25570423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 180 - 235
Target Start/End: Complemental strand, 13800758 - 13800703
Alignment:
| Q |
180 |
ctaacaaatgaaaactacctgcacaccaccagcgacgaattcgagttttgcaacaa |
235 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13800758 |
ctaacaaatgaaaaccaccagcacaccaccagcgacgaattcaagttttgcaacaa |
13800703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 245 - 293
Target Start/End: Original strand, 52767592 - 52767640
Alignment:
| Q |
245 |
caagttctcttaacatgtgtttgacactgaaaccctcaactcttacaac |
293 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
52767592 |
caagtactcttaacatgtgtttgacactgaaaccctcgacttttacaac |
52767640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University