View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16362_low_3 (Length: 339)
Name: NF16362_low_3
Description: NF16362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16362_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 8 - 323
Target Start/End: Original strand, 8091828 - 8092146
Alignment:
| Q |
8 |
agattatactcataagtt---tatttgacttttcttatctatatatgttgcagagcacaccaaggttttggatgggttggcgaatgggcaaacgcaaggt |
104 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8091828 |
agattatactcataagttgcttatttgacttttcttatctatatatgttgcagagcacaccaaggttttggatgggttggcgaatgggcaaacgcaaggt |
8091927 |
T |
|
| Q |
105 |
aggttggttagtttagtgcatctttaaattgatggtgcgtttggcaaaattacaatagcaccgtaattctaatgaaactttaaaatgtagtgatccagta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8091928 |
aggttggttagtttagtgcatctttaaattgatggtgcgtttggcaaaattacaatagcaccgtaattctaatgaaactttaaaatgtagtgatccagta |
8092027 |
T |
|
| Q |
205 |
gaattcattgtcagtccaaacatgcactcgtcgtacttgttttatatgagaattacacttggcatttagtttgactattactaacttttgatgtgggtgt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8092028 |
gaattcattgtcagtccaaacatgcactcgtcgtacttgttttatatgagaattacacttggcatttagtttgactattactaacttttgatgtgggtgt |
8092127 |
T |
|
| Q |
305 |
tgcagtaatgagtttggag |
323 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8092128 |
tgcagtaatgagtttggag |
8092146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University