View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16362_low_6 (Length: 309)

Name: NF16362_low_6
Description: NF16362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16362_low_6
NF16362_low_6
[»] chr2 (1 HSPs)
chr2 (38-235)||(25570422-25570621)
[»] chr6 (1 HSPs)
chr6 (180-235)||(13800703-13800758)
[»] chr3 (1 HSPs)
chr3 (245-293)||(52767592-52767640)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 38 - 235
Target Start/End: Complemental strand, 25570621 - 25570422
Alignment:
38 tgttgctgaacccatcaaatatgcctcgtcttcttgttgttgaacctggaaaagaaaagaaaattcaaccctttcctcaatcaaagatctaggcctggaa 137  Q
    |||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||    
25570621 tgttgctgaacccatcaaatctgcctcgttttcttgttgttgaacccggaaaagaaaagaaatttcaaccctttcctcaa-caaagatctaggcctggaa 25570523  T
138 aaacaataacaatcaatccaatcagttt---aagnnnnnnnnnnnctaacaaatgaaaactacctgcacaccaccagcgacgaattcgagttttgcaaca 234  Q
    |||||| |||||||||||||||||||||   ||            ||||||||||||||| ||| |||||||||||||||||||||| ||||||||||||    
25570522 aaacaacaacaatcaatccaatcagtttcagaaaagaaaaaaaaactaacaaatgaaaaccaccagcacaccaccagcgacgaattcaagttttgcaaca 25570423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 180 - 235
Target Start/End: Complemental strand, 13800758 - 13800703
Alignment:
180 ctaacaaatgaaaactacctgcacaccaccagcgacgaattcgagttttgcaacaa 235  Q
    ||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||    
13800758 ctaacaaatgaaaaccaccagcacaccaccagcgacgaattcaagttttgcaacaa 13800703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 245 - 293
Target Start/End: Original strand, 52767592 - 52767640
Alignment:
245 caagttctcttaacatgtgtttgacactgaaaccctcaactcttacaac 293  Q
    ||||| ||||||||||||||||||||||||||||||| ||| |||||||    
52767592 caagtactcttaacatgtgtttgacactgaaaccctcgacttttacaac 52767640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University