View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16363_high_7 (Length: 348)
Name: NF16363_high_7
Description: NF16363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16363_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 14 - 330
Target Start/End: Original strand, 48235396 - 48235712
Alignment:
| Q |
14 |
attattcttagtatcagtaaaaacttgattatcattacatccaaggcctcttaatctattaagctctggaagcacaactgatgcaagatttggcctatct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48235396 |
attattcttagtatcagtaaaaacttgattatcattaaatccaaggcctcttaatctattaagctctggaagcacaactgatgcaagatttggcctatct |
48235495 |
T |
 |
| Q |
114 |
ttcttgcagagttctgcacaattcaatgctaattttgcaaatgatagagcctcttcaactggccaatcagtcaccgcagaatcaagaatctccgaaaact |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48235496 |
ttcttgcagagttctgcacaattcaatgctaattttgcaaatgatagagcctcttcaactggccaatcagtcaccgcagaatcaagaatctctgaaaact |
48235595 |
T |
 |
| Q |
214 |
gctccttttcaattgcccttttaacatgatgagaaagtcccataggaggcctggctgtgattatctgcagtagcattatccctaatgaatatatatctga |
313 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48235596 |
ggtccttttcaattgcccttttaacatgatgagaaagtcccataggaggcctggctgtgattatctgcagtagcattatccctaatgaatatatatctga |
48235695 |
T |
 |
| Q |
314 |
ttttggtgttaacattc |
330 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
48235696 |
ttttggtgttaacattc |
48235712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 219 - 325
Target Start/End: Complemental strand, 3686899 - 3686793
Alignment:
| Q |
219 |
ttttcaattgcccttttaacatgatgagaaagtcccataggaggcctggctgtgattatctgcagtagcattatccctaatgaatatatatctgattttg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| | |||||||| || || || | |||||||||||| ||||| ||||||||||||| |
|
|
| T |
3686899 |
ttttcaattgcccttttaacatgatgagaaagtcccattggaggcttagctgtgataatttgaagaaacattatccctaaagaataaatatctgattttg |
3686800 |
T |
 |
| Q |
319 |
gtgttaa |
325 |
Q |
| |
|
|||||| |
|
|
| T |
3686799 |
ttgttaa |
3686793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 135 - 187
Target Start/End: Complemental strand, 42674307 - 42674255
Alignment:
| Q |
135 |
ttcaatgctaattttgcaaatgatagagcctcttcaactggccaatcagtcac |
187 |
Q |
| |
|
||||| |||||||| |||| ||||| ||||||||| || |||||||||||||| |
|
|
| T |
42674307 |
ttcaaagctaatttagcaagtgataaagcctcttcgaccggccaatcagtcac |
42674255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University