View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16363_low_2 (Length: 502)
Name: NF16363_low_2
Description: NF16363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16363_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 1e-48; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 216 - 314
Target Start/End: Original strand, 47957038 - 47957136
Alignment:
| Q |
216 |
gcaaaagttatatcaatatggtaacgtttttgtattgaaattgcccctcattttacaagaagtgtacaaatacggttgttttcaaacacaatttgaaag |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47957038 |
gcaaaagttatatcaatatggtaacgtttttgtattgaaattgcccctcattttacaagaagtgtacaaatacggttgttttcaaacacaatttgaaag |
47957136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 410 - 480
Target Start/End: Original strand, 47957232 - 47957302
Alignment:
| Q |
410 |
gtacgagtctggtttgcagatacgagacccttgtgagagaatctaaaggtccgaacaattgctgcactgca |
480 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47957232 |
gtacgagtctcgtttgcagatacgagacccttgtgagagaatctaaaggtccgaacaattgctgcactgca |
47957302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 47956823 - 47956907
Alignment:
| Q |
1 |
atgaaatatcctacccagtacccacgacccccaccttcttgtctgggtctaaagtttgtctgccccttttgcaacaacaattgaa |
85 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
47956823 |
atgaaatatcctacacagtacccacgacccccaccttcttgtctaggtctaaagtttgtccgtcccttttgaaacaacaattgaa |
47956907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University