View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16364_low_12 (Length: 280)
Name: NF16364_low_12
Description: NF16364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16364_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 269
Target Start/End: Original strand, 24509401 - 24509652
Alignment:
| Q |
18 |
acttcctctgattctactatttcttctgaccaaggaaatgctgggaaatcggtcttgtcaaatctgaattttattttatattcacatttgaatgtgtttt |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24509401 |
acttcctccgattctactatttcttctgaccaaggaaatgctgggaaatcggtcttgtcaaatctgaattttattttatattcacatttgaatgtgtttt |
24509500 |
T |
 |
| Q |
118 |
cctttttgatatcagttatggcaatacttatcatgactccgtggggggccgtaggcggtactctggtgttcggtccggtggtttggttcgcccttagtta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24509501 |
cctttttgatatcagttatggcaatacttatcatgactccgtggggggccgtaggcggtactctggtgttcggtccggtggtttggtttgcccttagtta |
24509600 |
T |
 |
| Q |
218 |
tatgtatgctatggcggtcatatcccctgcacctttcagtcccttaattcat |
269 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24509601 |
tatgtatgctatgacggtcatatcccctgcacctttcagtcccttaattcat |
24509652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University