View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16367_low_3 (Length: 461)
Name: NF16367_low_3
Description: NF16367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16367_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 398; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 19 - 444
Target Start/End: Original strand, 23596321 - 23596746
Alignment:
| Q |
19 |
tagaagcctgagcatacccccttgcaaatctgaacagcccacttccacccacaaccggcatctctctcacggcggattcaattgtattcctgcccaaaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||||| |||||||| |
|
|
| T |
23596321 |
tagaagcctgagcatacccccttgcaaatctgaacagcccactaccacccacaaccggcatctctctcacggcggattcgatcgtattccttcccaaaat |
23596420 |
T |
 |
| Q |
119 |
actgagattacttccattgtacttcccttgtgtgaaagcaaaattaagcaccatgagaaacccaacttcactttgtgaagctgaagcatagattccttgt |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23596421 |
actgagattacttccattatacttcccttgtgtgaaagcaaagttaagcaccatgagaaacccaacttcactttgtgaagctgaagcatagattccttgt |
23596520 |
T |
 |
| Q |
219 |
gctcttcccacaacttcggaatttgactccggacgggctgttaacgggtcgtccatcataaccactgaaccaaaacccgtgggggatttttcagtggttg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23596521 |
gctcttcccacaacttcggaatttgactccggacgggctgttaacgggtcgtccatcataaccactgaaccaaaacccgtgggggatttttcagtggttg |
23596620 |
T |
 |
| Q |
319 |
gagatgaggcgacccggacagcagtttggttttttccgccgatgatgtcgtggaagtagaagcggatgtggcttagtttttgaggtttgtggagtcctag |
418 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23596621 |
gagatgaggcgacccggacagcggtttggttttttccgccgatgatgtcgtggaagtagaagcggatgtggcttagtttttgaggtttgtggagtcctag |
23596720 |
T |
 |
| Q |
419 |
ggttgttggggagatggtttttatga |
444 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
23596721 |
ggttgttggggagatggtttttatga |
23596746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University