View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16368_low_6 (Length: 246)
Name: NF16368_low_6
Description: NF16368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16368_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 37787983 - 37788211
Alignment:
| Q |
1 |
tttcctcagaacttgagcttgatcccttctcagcagaaccttaaacattattaggggcacaaattagcttcaattttcaatacaagcaaaaatcactcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37787983 |
tttcctcagaacttgagcttgatcccttctcagcagaaccttaaacattattgggggcacaaattaacttcaattttcaatacaagcaaaaatcactcaa |
37788082 |
T |
|
| Q |
101 |
taacaatactatatatagtattactactaaaattaattaccgctggaaataggggtggaactgtttgttttggtagaatttccaagtccttcaaacacct |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37788083 |
taacaatactatatttagtattactactaaagttaattaccgctggaaataggggtggaactgtttgttttggtagaatttccaagtccttcaaacacct |
37788182 |
T |
|
| Q |
201 |
tagcttcaggggatttaggtgacaaatgt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37788183 |
tagcttcaggggatttaggtgacaaatgt |
37788211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University