View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16368_low_8 (Length: 217)
Name: NF16368_low_8
Description: NF16368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16368_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 14 - 81
Target Start/End: Original strand, 2768881 - 2768948
Alignment:
| Q |
14 |
acatcatcaccgtaccgttcaagtaagannnnnnnctcttcactcgccaacccatttcctgattctgc |
81 |
Q |
| |
|
||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2768881 |
acatcataaccataccgttcaagtaagatttttttctcttcactcgccaacccatttcctgattctgc |
2768948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University