View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16369_high_5 (Length: 396)
Name: NF16369_high_5
Description: NF16369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16369_high_5 |
 |  |
|
| [»] scaffold1064 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1064 (Bit Score: 126; Significance: 7e-65; HSPs: 1)
Name: scaffold1064
Description:
Target: scaffold1064; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 101 - 230
Target Start/End: Complemental strand, 2704 - 2575
Alignment:
| Q |
101 |
tctcaatggaaaaccatcatgtagtaattgcagagtatattgctgcatactataaagaaactagagttttgattagttaggatcagattcctgacaagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2704 |
tctcaatggaaaaccatcatgtagtaattgcagagtatattgctgcatactacaaagaaactagagttttgattagttaggatcagattcctgacaagat |
2605 |
T |
 |
| Q |
201 |
aggtgaacctctgaagccaagaaggatgag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2604 |
aggtgaacctctgaagccaagaaggatgag |
2575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 120 - 206
Target Start/End: Complemental strand, 26825385 - 26825299
Alignment:
| Q |
120 |
tgtagtaattgcagagtatattgctgcatactataaagaaactagagttttgattagttaggatcagattcctgacaagataggtga |
206 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || || ||| ||||| |||| |||||||||||| |||||||||||||| |
|
|
| T |
26825385 |
tgtagtaattgcagagtacattgctgcatactacaaggagactggagttcccattaagcgggatcagattccagacaagataggtga |
26825299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University