View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1637-INSERTION-3 (Length: 157)
Name: NF1637-INSERTION-3
Description: NF1637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1637-INSERTION-3 |
| |
|
[»] chr2 (1 HSPs) |
| |
|
[»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 8 - 157
Target Start/End: Original strand, 45514297 - 45514446
Alignment:
Q |
8 |
aaacctgttttttcatatggactttcacgtgactgtgcggtgaatgtcacaaactgtctatagcgtgcataaaccatgcagtcttgaaatacagcggcag |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45514297 |
aaacctgttttttcatatggactttcacgtgactgtgcggtgaatgtcacaaactgtctatagcgtgcataaaccatgcagtcttgaaatacagcggcag |
45514396 |
T |
|
Q |
108 |
cgttgccgtagatgaagtcgacagtgccgtatatttcacagtttttgtag |
157 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45514397 |
cgttgccgtagatgaagtcgacagtgccgtatatttcacagtttttgtag |
45514446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 94; Significance: 3e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 8 - 157
Target Start/End: Original strand, 43699495 - 43699644
Alignment:
Q |
8 |
aaacctgttttttcatatggactttcacgtgactgtgcggtgaatgtcacaaactgtctatagcgtgcataaaccatgcagtcttgaaatacagcggcag |
107 |
Q |
|
|
||||||||||||||| ||||| || ||||||| |||||||||||| ||| ||||||| |||||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
43699495 |
aaacctgttttttcagatggatttccacgtgattgtgcggtgaataccacgaactgtcgatagcgtgcataaaccatacagtcttgaaatacagctgcag |
43699594 |
T |
|
Q |
108 |
cgttgccgtagatgaagtcgacagtgccgtatatttcacagtttttgtag |
157 |
Q |
|
|
|||||||| ||||||||||||| || || ||||||||||||||||||||| |
|
|
T |
43699595 |
cgttgccgaagatgaagtcgacggtaccatatatttcacagtttttgtag |
43699644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4485 times since January 2019
Visitors: 5897