View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1637-INSERTION-3 (Length: 157)

Name: NF1637-INSERTION-3
Description: NF1637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1637-INSERTION-3
NF1637-INSERTION-3
[»] chr2 (1 HSPs)
chr2 (8-157)||(45514297-45514446)
[»] chr7 (1 HSPs)
chr7 (8-157)||(43699495-43699644)


Alignment Details
Target: chr2 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 8 - 157
Target Start/End: Original strand, 45514297 - 45514446
Alignment:
8 aaacctgttttttcatatggactttcacgtgactgtgcggtgaatgtcacaaactgtctatagcgtgcataaaccatgcagtcttgaaatacagcggcag 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45514297 aaacctgttttttcatatggactttcacgtgactgtgcggtgaatgtcacaaactgtctatagcgtgcataaaccatgcagtcttgaaatacagcggcag 45514396  T
108 cgttgccgtagatgaagtcgacagtgccgtatatttcacagtttttgtag 157  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
45514397 cgttgccgtagatgaagtcgacagtgccgtatatttcacagtttttgtag 45514446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 94; Significance: 3e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 8 - 157
Target Start/End: Original strand, 43699495 - 43699644
Alignment:
8 aaacctgttttttcatatggactttcacgtgactgtgcggtgaatgtcacaaactgtctatagcgtgcataaaccatgcagtcttgaaatacagcggcag 107  Q
    ||||||||||||||| ||||| || ||||||| ||||||||||||  ||| ||||||| |||||||||||||||||| ||||||||||||||||| ||||    
43699495 aaacctgttttttcagatggatttccacgtgattgtgcggtgaataccacgaactgtcgatagcgtgcataaaccatacagtcttgaaatacagctgcag 43699594  T
108 cgttgccgtagatgaagtcgacagtgccgtatatttcacagtttttgtag 157  Q
    |||||||| ||||||||||||| || || |||||||||||||||||||||    
43699595 cgttgccgaagatgaagtcgacggtaccatatatttcacagtttttgtag 43699644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4485 times since January 2019
Visitors: 5897