View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16371_high_4 (Length: 253)

Name: NF16371_high_4
Description: NF16371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16371_high_4
NF16371_high_4
[»] chr7 (1 HSPs)
chr7 (6-224)||(36727530-36727751)


Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 6 - 224
Target Start/End: Complemental strand, 36727751 - 36727530
Alignment:
6 gatgtcgaagaaaatagtagcaccatcaaaagccatggcttaatttagggccaaatgatttgtttctttttctttgagttaattaaaagcttacagttac 105  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
36727751 gatgtagaagaaaatagtagcaccatcaaaagccatggcttaatttagggccaaatgacttgtttctttttctttgagttaattaaaagcttacagttac 36727652  T
106 gagatgcaaaacatctattatgtgatgtcttactta---tattgaatcagctgcttttttaatcaataaaaatagaatcccaaattgcttaatcatacca 202  Q
     |||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36727651 aagatgcaaaacatctattatgtgatgtcttacttatattattgaatcagctgcttttttaatcaataaaaatagaatcccaaattgcttaatcatacca 36727552  T
203 taaaattgttagaaactctttc 224  Q
    ||||||||||||||||||||||    
36727551 taaaattgttagaaactctttc 36727530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University