View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16371_high_6 (Length: 243)
Name: NF16371_high_6
Description: NF16371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16371_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 31045211 - 31045341
Alignment:
| Q |
1 |
ataaaataatcttttattagaaaataaaaattacatgtacaaggaaaaagaatggtgaaacatgtactataattaagatcaatttaagcttatcttcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31045211 |
ataaaataatcttttattagaaaataaaaattacacgtacaaggaaaaagaatggtgaaacatgtactataattaagatcaatttaagcttatcttcaac |
31045310 |
T |
 |
| Q |
101 |
aaaggtaattaactagcttggttggtaagta |
131 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |
|
|
| T |
31045311 |
aatggtaattaactagcttggttggtaagta |
31045341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University