View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16371_low_5 (Length: 253)
Name: NF16371_low_5
Description: NF16371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16371_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 6 - 224
Target Start/End: Complemental strand, 36727751 - 36727530
Alignment:
| Q |
6 |
gatgtcgaagaaaatagtagcaccatcaaaagccatggcttaatttagggccaaatgatttgtttctttttctttgagttaattaaaagcttacagttac |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36727751 |
gatgtagaagaaaatagtagcaccatcaaaagccatggcttaatttagggccaaatgacttgtttctttttctttgagttaattaaaagcttacagttac |
36727652 |
T |
 |
| Q |
106 |
gagatgcaaaacatctattatgtgatgtcttactta---tattgaatcagctgcttttttaatcaataaaaatagaatcccaaattgcttaatcatacca |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36727651 |
aagatgcaaaacatctattatgtgatgtcttacttatattattgaatcagctgcttttttaatcaataaaaatagaatcccaaattgcttaatcatacca |
36727552 |
T |
 |
| Q |
203 |
taaaattgttagaaactctttc |
224 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36727551 |
taaaattgttagaaactctttc |
36727530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University