View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16371_low_7 (Length: 243)

Name: NF16371_low_7
Description: NF16371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16371_low_7
NF16371_low_7
[»] chr1 (1 HSPs)
chr1 (1-131)||(31045211-31045341)


Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 31045211 - 31045341
Alignment:
1 ataaaataatcttttattagaaaataaaaattacatgtacaaggaaaaagaatggtgaaacatgtactataattaagatcaatttaagcttatcttcaac 100  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31045211 ataaaataatcttttattagaaaataaaaattacacgtacaaggaaaaagaatggtgaaacatgtactataattaagatcaatttaagcttatcttcaac 31045310  T
101 aaaggtaattaactagcttggttggtaagta 131  Q
    || ||||||||||||||||||||||||||||    
31045311 aatggtaattaactagcttggttggtaagta 31045341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University