View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16372_high_6 (Length: 227)
Name: NF16372_high_6
Description: NF16372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16372_high_6 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 27839792 - 27840013
Alignment:
| Q |
6 |
aatatgacaatccatggtacatttggaagcatgagtatcatcgtttcgaattatctttttgttataaaaacaacttttttcaaggcaataaacaaggtcg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27839792 |
aatatgacaatccatggtacatttggaagcatgagtatcatcgtttcgaattatctttttgttataaaaacaacttttttcaaggcaataaacaaggtcg |
27839891 |
T |
 |
| Q |
106 |
taccaataaaattgaagatatgttctaaaattaagatttgagcataatttggttcaaagttagtagaaatcaatttatagaggtatgtatagttggcttc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
27839892 |
taccaataaaattgaagatatgttctaaaattaagatttgagcataatttggttcaaagctagtaaaaatcaatttatagaggtatgtataattggcttc |
27839991 |
T |
 |
| Q |
206 |
tttcatgtcttttttgaaagac |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27839992 |
tttcatgtcttttttgaaagac |
27840013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University