View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16374_high_2 (Length: 225)
Name: NF16374_high_2
Description: NF16374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16374_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 213
Target Start/End: Original strand, 2553805 - 2554004
Alignment:
| Q |
15 |
atactactaatgaatattttctttcaaagggtaaggagaaatattgatatgcacacggtttcgataaacatctcatgcaatgcatatgatattgttctgc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2553805 |
atactactaatgaatattttctttcaaagggtaaggagaaatattgatatgcacacggttttgataaacatctcatgcaatgcatatgatattgttctgc |
2553904 |
T |
|
| Q |
115 |
-nnnnnnngtctgatcactagtcaagtggtataataattttaagtgcaggttgtcgcaagcaaattactgcaaacagaaagaaaactgtgatgctgatga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2553905 |
aaaaaaaagtctgatcactagtcaagtggtataataattttaagtgcaggttgtcgcaagcaaattactgcaaacagaaagaaaactgtgatgctgatga |
2554004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University