View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16375_high_10 (Length: 253)
Name: NF16375_high_10
Description: NF16375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16375_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 31 - 247
Target Start/End: Original strand, 11712593 - 11712812
Alignment:
| Q |
31 |
ataataggtaggatgtttgtatttttcttctcttcttggtaaaagcaaaacagtgtttttagcttcttaaaaaagtaatactatgttggatgtttgtatt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11712593 |
ataataggtaggatgtttgtatttttcttctcttcttggtaaaagcaaaacagtgtttttagcttcttaaaaaagtaatactatgttggatgtttgtatt |
11712692 |
T |
 |
| Q |
131 |
tatcttcttgttttcttgttgttgaaagtggtgaaaattagagcttggaagctagtgaaaagttggaaaaagatttgcgt---gaaaatataaacagaga |
227 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| | | |
|
|
| T |
11712693 |
tatcttcttgccttcttgttgttgaaagtggtgaaaattagagcttggaagctagtgaaaagttggaaaaagatttgtgtgaagaaaatataaacaaaca |
11712792 |
T |
 |
| Q |
228 |
aaagagaatcaatcatctaa |
247 |
Q |
| |
|
|||||| |||| |||||||| |
|
|
| T |
11712793 |
aaagagcatcattcatctaa |
11712812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University