View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16375_low_13 (Length: 224)
Name: NF16375_low_13
Description: NF16375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16375_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 39 - 210
Target Start/End: Complemental strand, 54337229 - 54337058
Alignment:
| Q |
39 |
attgaaaatatgtaaatcaggttgagaatggagactttattggaggatatcagttttcttattattgttatttagcatttcaatttcccaaaataatgag |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54337229 |
attgaaaatatgtaaatcaggttgagaatggagactttattggaggatatcagttttcttactattgttatttagcatttcaatttcccaaaataatgag |
54337130 |
T |
|
| Q |
139 |
ggatgattttgtctgcttataacagcttgtgatgtgttctgttttgtacatacaggaagttctggcacaggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54337129 |
ggatgattttgtctgcttataacagcttgtgatgtgttctgttttgtacatacaggaagttctggcacaggt |
54337058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University