View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16376_low_5 (Length: 220)
Name: NF16376_low_5
Description: NF16376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16376_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 22 - 204
Target Start/End: Original strand, 32888708 - 32888889
Alignment:
| Q |
22 |
gaatgagcgttgaccgttgaagatagattgtttataatagttttagtgtttcgatatttgatgnnnnnnnnncacgagatactttgtgtgtttatcattg |
121 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
32888708 |
gaatgagtgttgactgttgaagatagattgtttataatagttttagtgtttcgatatttggtgtttttttt-cacgagatactttgtgtgtttatcattg |
32888806 |
T |
 |
| Q |
122 |
tcgttttttaagacattttgatatgatttatgatgtgtatgtgtttggttctacaagagaaaactttgattttgaattaattg |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32888807 |
tcgtttttcaagacattttgatatgatttatgatgtgtatgtgtttggttctacaagagaaaactttgattttggattaattg |
32888889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University