View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_high_106 (Length: 225)
Name: NF16378_high_106
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_high_106 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 2741365 - 2741567
Alignment:
| Q |
1 |
aacaaatgtttgaatctcatatctaagattccattgaagaaaataagcatttgaaaaataacggaga-catgagctgaaacagagtctgtctgtccctga |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||| |||||||||| |||||||||| |||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
2741365 |
aacaaatgtttgaatctcatatctaagatttcatcgaataaaataagcagttgaaaaatagcggagatcatgagctgaaacagagtctgtttgtacctga |
2741464 |
T |
 |
| Q |
100 |
agtcggatgttcattccagaggtttgggtgaaatttgggttaatggagtttggatagctgatcaatagtgatcattttgatatataaaagtgagagatga |
199 |
Q |
| |
|
||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
2741465 |
agttacatgttcattccagaggtttgagtgaaatttgggttaatggagtttggatagctgatcaatagtgatcattttgttatataaaagtgagagacga |
2741564 |
T |
 |
| Q |
200 |
ttt |
202 |
Q |
| |
|
||| |
|
|
| T |
2741565 |
ttt |
2741567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University