View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_high_38 (Length: 409)
Name: NF16378_high_38
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 1 - 390
Target Start/End: Original strand, 50355976 - 50356359
Alignment:
| Q |
1 |
taagatgcaagaggctgtttaccacgggagacagagggggtaaggaatggagatagacctagtctgccattggaagcactgccttcgccggtgtaatggc |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50355976 |
taagatgtaagaggctgtttaccacgggagacagagggggtaaggaatggagatagacctagtctgccattggaaccactgccttcgccggtgtaatggc |
50356075 |
T |
 |
| Q |
101 |
cggtaatgggggaggacatgaatggtgtgatggatgaaagaggctgtttaccttgggagacagcgggggtggggatgatagatggacatggacatggacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50356076 |
cggtaatgggggaggacatgaatggtgtgatggatgaaagaggctgtttacctcgggagacagcgggggtggggatgatagatgg------acatggacc |
50356169 |
T |
 |
| Q |
201 |
tagcctgccattggaaacactgccgtcgcaggtgatggcggaggacaggagtgatggaaaactaaatgtttccttggggatttctagatctaaggattta |
300 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50356170 |
tagcctgccatcggaaacactgccgtcgccggtgatggcggaggacaggagtgatggaaaactaaatgtttccttggggatttctagatctaaggattta |
50356269 |
T |
 |
| Q |
301 |
gggttagatctaaaggtgtaaggtttagtaaaatcgagagttaaaggttggttatggctcttgggaggaatttgaatttgaagtggtggt |
390 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50356270 |
gggttagatataaaggtgtaaggtttagtaaaatcgagagttaaaggttggttatggctcttgggaggaatttgaatttgaagtggtggt |
50356359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University