View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_high_49 (Length: 369)
Name: NF16378_high_49
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_high_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 109 - 312
Target Start/End: Complemental strand, 43037657 - 43037453
Alignment:
| Q |
109 |
attcaacaacctccgcccccgctttccaccttgactatgccgctctccatcgtctctccggcaaactcctcac-ctctccatctttgtttacaacggccc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43037657 |
attcaacaacctccgcccccgctttccaccttgactatgctgctctccatcgtctctccggcaaactcctcactctctccatctttgtttacaacggccc |
43037558 |
T |
 |
| Q |
208 |
aattggccgcaactgtggcgtccgcaatgccaagctactcggtcgtgtccttcttcccattcaattacctacctcattctcttcccccaatattttccac |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43037557 |
aattggccgcaactgtggcgtccgcaatgccaagctactcggtcgtgtccttcttcccattcaattacctacctcattctcttcccccaatactttccac |
43037458 |
T |
 |
| Q |
308 |
aatgg |
312 |
Q |
| |
|
||||| |
|
|
| T |
43037457 |
aatgg |
43037453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 308 - 355
Target Start/End: Complemental strand, 43037431 - 43037384
Alignment:
| Q |
308 |
aatggatgataaaccttcacatttgcttcacgttatggtccggtctga |
355 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43037431 |
aatggatgataaaccttcacatttgctacacgttatggtccggtctga |
43037384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University