View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_high_54 (Length: 346)
Name: NF16378_high_54
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_high_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 42 - 344
Target Start/End: Original strand, 52376471 - 52376773
Alignment:
| Q |
42 |
cctttaggtgcacctgaaggtgcaaccatttgatcatcgtcatcatcatcgtctgttagatccccttgaggtgctccggctggcgacacaattggagcac |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
52376471 |
cctttaggtgcacctgaaggtgcaaccatttgatcatcgtcatcatcatcatctgttagatccccttgaggtgctccggttggagacacaattggagcac |
52376570 |
T |
 |
| Q |
142 |
ttccaggtgctttagaactaccggctacattctcgccattgccttttggtgcctctgcaggcgcgttggtggatgctgctgtgggtgcatttgtgggtgc |
241 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52376571 |
tttcaggtgctttagaactaccggctacattcgcgccattgccttttggtgcctctgcaggcgcgttggtggatgctgctgtgggtgcatttgtgggtgc |
52376670 |
T |
 |
| Q |
242 |
agattcaggtgttttgcttggttcgtttgatggtgcatttgttggtgcttgttgtggtgatttattggatgaaccatctgttgttggtgtctgtgctcct |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
52376671 |
agattcaggtgttttgcttggttcgtttgatggtgcatttgttggtgcttgttgtggtgatttattggatgaaccatctgctgttggtgtcggtgctcct |
52376770 |
T |
 |
| Q |
342 |
cct |
344 |
Q |
| |
|
||| |
|
|
| T |
52376771 |
cct |
52376773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 52376442 - 52376481
Alignment:
| Q |
1 |
ctatacttcaatcatcatctgtagaggtccctttaggtgc |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52376442 |
ctatacttcaatcatcatctgtagaggtccctttaggtgc |
52376481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University