View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_high_82 (Length: 272)
Name: NF16378_high_82
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_high_82 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 4 - 255
Target Start/End: Original strand, 40839074 - 40839325
Alignment:
| Q |
4 |
aagaacaatcacacctaaaccacaatttaaaaccatgattgagtagtcaacatagtagcatagaagaaaaaggattgttaccgatcgaaggaaactcagt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839074 |
aagaacaatcacacctaaaccacaatttaaaaccatgattgagtagtcaacatagtagcatagaagaaaaaggattgttaccgatcgaaggaaactcagc |
40839173 |
T |
 |
| Q |
104 |
ttctgtccccggctgcgaccatcgggggaagtcaagtctatagtctcagtgctatctacattgtgaagagttgttggatggcccaaaggtctctgacccc |
203 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839174 |
ttctgtccccggctgcgaccatcggttgaagtcaagtctatagtctcagtgctatctacattgtgaagagttgttggatggcccaaaggtctctgacccc |
40839273 |
T |
 |
| Q |
204 |
taacattattcccaacttgccaaacatggttcaaccttgttatgttatattt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839274 |
taacattattcccaacttgccaaacatggttcaaccttgttatgttatattt |
40839325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University