View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_low_101 (Length: 241)
Name: NF16378_low_101
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_low_101 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 21 - 224
Target Start/End: Original strand, 9984235 - 9984436
Alignment:
| Q |
21 |
taggaagaaatggagttcatgaatcagtggaaaatatatatgttcgaaattgcactttcaatgggacaacaaatggagccagaatcaagacatggatagt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9984235 |
taggaagaaatggagttcatgaatcagtggaaaatatatatgttcgaaattgcactttcaataggacaacaaatggagccagaatcaagacatggatagt |
9984334 |
T |
 |
| Q |
121 |
aagatatacttctactctatttaatttgctannnnnnnnnnnnnnnnngaagaaattaatttagttcacccaaattggtttgacatttactagcacatga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9984335 |
aagatatacttctactctatttaatttggta--tttttttattttcttgaagaaattaatttagttcacccaaattggtttgacatttactagcacctga |
9984432 |
T |
 |
| Q |
221 |
aaat |
224 |
Q |
| |
|
|||| |
|
|
| T |
9984433 |
aaat |
9984436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University