View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16378_low_102 (Length: 239)
Name: NF16378_low_102
Description: NF16378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16378_low_102 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 162 - 222
Target Start/End: Complemental strand, 49093914 - 49093854
Alignment:
| Q |
162 |
cacttattaagtcagggattttaagtgggcagttatccaccagacttaaaaacatgggtag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49093914 |
cacttattaagtcagggattttaagtgggcagttatccaccagacttaaaaacatgggtag |
49093854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 197
Target Start/End: Complemental strand, 16883302 - 16883267
Alignment:
| Q |
162 |
cacttattaagtcagggattttaagtgggcagttat |
197 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16883302 |
cacttattaactcagggattttaagtgggcagttat |
16883267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 162 - 220
Target Start/End: Complemental strand, 21373772 - 21373714
Alignment:
| Q |
162 |
cacttattaagtcagggattttaagtgggcagttatccaccagacttaaaaacatgggt |
220 |
Q |
| |
|
|||||||||||||| || ||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
21373772 |
cacttattaagtcaaggtttttaagtgggttgttatccaccagatttaaaaacatgggt |
21373714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 162 - 220
Target Start/End: Original strand, 11764216 - 11764274
Alignment:
| Q |
162 |
cacttattaagtcagggattttaagtgggcagttatccaccagacttaaaaacatgggt |
220 |
Q |
| |
|
|||||||||||||| || ||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
11764216 |
cacttattaagtcaaggtttttaagtgggttgttatccaccagatttaaaaacatgggt |
11764274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University